cytologia płynna

Klonalność w ziarniniakowej dominującej limfocytach czesc 4

W tym badaniu jednak, stosując analizę PCR pojedynczych komórek uzyskanych przez mikromanipulację, wykazaliśmy klonalne populacje komórek L & H u wszystkich pięciu pacjentów z dominującą chorobą limfocytów z ziarnicą złośliwą. Populacje te okazały się obecne w całym guzie u czterech z pięciu pacjentów, ponieważ komórki L & H z i...

Klonalność w ziarniniakowej dominującej limfocytach ad

W tym celu oryginalny produkt PCR CDR3 ponownie amplifikowano w objętości 50 .l z zagnieżdżonymi starterami VH i JH z sekwencjami M13 przyłączonymi do ich 5 końcach (sekwencje, M13 + VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG, M13R + JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). Produkty oczyszczono na żelu i bezpośrednio sekwencjonowano...

cytologia płynna

Bóle krzyża dotykają od 70 do 80 procent dorosłych w pewnym okresie.1 W Stanach Zjednoczonych i Kanadzie 2-4 urazy kręgosłupa stanowią 15-25 procent urazów objętych rekompensatą pracowniczą i stanowią od 30 do 40 procent pracowników rekompensaty. Większość roszczeń odszkodowawczych związanych z urazem kręgosłupa (87 procent) dotyc...

Najnowsze zdjęcia w galerii cytologia płynna :



Alergia skórna ad

Napisane przy pomocy licznych autorów, z których wielu ukształtowało naszą wiedzę na temat zaburzeń, o których dyskutują, to czytelne kompendium jest skierowane głównie do zainteresowanych lekarzy, zarówno dermatologów, jak i lekarzy podstawowej opieki zdrowotnej. Wstępny rozdział dotyczący immunobiologii skóry jest obszerny, ze zroz...