chondropatia rzepki

Lepsza przeżywalność u pacjentów z miejscowo zaawansowanym rakiem prostaty leczonych za pomocą radioterapii i gosereliny

Rola napromieniania zewnętrznego u chorych na miejscowo zaawansowanego raka prostaty budzi kontrowersje.1,2 Na tym etapie choroby nowotwór wykracza poza kapsułę prostaty; może infiltrować sąsiednie struktury i obejmować regionalne węzły chłonne, ale nie ma przerzutów odległych (stadium T3-4, N0-2, M0, zgodnie z systemem klasyfikacji przerzutów do węzł...

chondropatia rzepki

W obecnych doświadczeniach kontrola obejmowała pominięcie pierwotnego lub wtórnego przeciwciała. Przeciwciało ACTH wytworzono przeciwko aminokwasom <24 ACTH [ACTH (1-2)). Potencjalna reaktywność krzyżowa była ograniczona do a-MSH. Tabela 3 Przeciwciała podstawowe RT-PCR. Całkowity RNA wyizolowano z tkanek przy użyciu Tri-Reagent (Sigma-Aldrich), a cDNA zs...

Najnowsze zdjęcia w galerii chondropatia rzepki :



Klonalność w ziarniniakowej dominującej limfocytach ad

W tym celu oryginalny produkt PCR CDR3 ponownie amplifikowano w objętości 50 .l z zagnieżdżonymi starterami VH i JH z sekwencjami M13 przyłączonymi do ich 5 końcach (sekwencje, M13 + VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG, M13R + JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). Produkty oczyszczono na żelu i bezpośrednio sekwencjonowano starterami do M1...

Wynik transplantacji krwi pępowinowej od pokrewnych i niepowiązanych dawców ad

Zwykle pełną krew zamrożono w 10% dimetylosulfotlenku i rozmrożono zgodnie z metodą stosowaną w banku krwi pępowinowej w Nowym Jorku .6,7 Krew pępowinową dostarczono z banków krwi pępowinowej w Nowym Jorku (47 przypadków), Mediolan, Włochy (14), Paryż (11), Dusseldorf, Niemcy (6) i okolice centrum (65). Zebrana mediana objętości wynosiła 99 ml (zakres...