Klonalność w ziarniniakowej dominującej limfocytach ad

W tym celu oryginalny produkt PCR CDR3 ponownie amplifikowano w objętości 50 .l z zagnieżdżonymi starterami VH i JH z sekwencjami M13 przyłączonymi do ich 5 końcach (sekwencje, M13 + VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG, M13R + JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). Produkty oczyszczono na żelu i bezpośrednio sekwencjonowano starterami do M13 w orientacji do przodu i M13R w orientacji odwrotnej i...

Probukol i multiwitaminy w zapobieganiu restenozy po angioplastyki wieńcowej ad 6

Krzywe wyraźnie faworyzują probukol podczas obserwacji. PTCA oznacza przezskórną angioplastykę wieńcową. Restenoza wystąpiła w 20,7 procentach rozszerzonych segmentów w grupie probukolowej, 28,9 procent w grupie leczenia skojarzonego, 40,3 procent w grupie multiwitaminowej i 38,9 procentach w grupie placebo (P = 0,003 dla probukolu vs. bez probukolu, a P = 0,89 dla witamin vs. bez witamin). Częstoś...

Nadzór PET-CT a wycięcie szyi w zaawansowanym raku głowy i szyi czesc 4

Konieczne będą badania porównawcze zarówno na poziomie przedklinicznym, jak i klinicznym, w celu określenia, które kombinacje oferują najbardziej skuteczne metody z najmniejszą toksycznością. Kliniczny rozwój PARAs PARAs w fazie rozwoju, mapatumumab ukierunkowany na DR4 mapatumumab jest przedmiotem najbardziej zaawansowanych badań, z wynikami II fazy (Tabela 3). Dane Fazy I istnieją również dla podwójnych (...

Najnowsze zdjęcia w galerii polskaszkolawcork:

174#chondropatia rzepki , #choroba dercuma , #choroba duhringa zdjęcia , #choroba scheuermanna operacja , #co na katar zatokowy , #cukrzyca typu lada , #cysta naskórkowa , #cystoskopia boli , #cytologia płynna , #czepota puszysta ,