Klonalność w ziarniniakowej dominującej limfocytach ad

W tym celu oryginalny produkt PCR CDR3 ponownie amplifikowano w objętości 50 .l z zagnieżdżonymi starterami VH i JH z sekwencjami M13 przyłączonymi do ich 5 końcach (sekwencje, M13 + VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG, M13R + JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). Produkty oczyszczono na żelu i bezpośrednio sekwencjonowano starterami do M13 w orientacji do przodu i M1...

Mechanizmy zespołu autoimmunologicznego u myszy wywołane dominującą mutacją w Aire cd

Aby ustalić, czy obecność allelu G228W jest predysponowana do autoimmunizacji, myszy w wieku od 15 do 25 tygodni Aire + / +, AireGW / + i AireGW / GW w mieszanym tle genetycznym C57BL / 6-129 analizowano pod kątem obecności limfocytów. infiltruje w wybranych narządach. Jak pokazano na ryc. 2, skrawki histologiczne gruczołów łzowych i ślinowych myszy AireGW / + wykazywały obszary nacie...

Surveillance for Escherichia coli O157: H7 Infections in Minnesota, podtyp molekularny

Ponieważ Escherichia coli O157: H7 został zidentyfikowany jako patogen jelitowy w 1982 r., Był przedmiotem wielu epidemii i innych badań epidemiologicznych.1 Jednak epidemiologia molekularna i ekologia tego organizmu u ludzi i zwierząt nadal wymagają zdefiniowania bardziej całkowicie. Na przykład w 1994 i 1995 roku 64 epidemie E. coli O157: H7 zgłoszono do Ośrodków Kontroli i Profilakt...

Nosowe powóz jako źródło Staphylococcus aureus Bacteremia cd

Tylko 15 wzorów (10 procent) zidentyfikowanych w 1994 r. Zaobserwowano również w 1995 r. Figura 2. Figura 2. Przypadki zakażenia E. coli O157: H7 według tygodnia początkowego (górny panel) i według wzoru na elektroforezie żelowej w polu impulsowym (PFGE) (dolny panel), Minnesota, 1994. W dolny panel, każde białe pole reprezentuje pojedynczy, niepowiązany wzór PFGE, a każ...

Najnowsze zdjęcia w galerii polskaszkolawcork:

174#chondropatia rzepki , #choroba dercuma , #choroba duhringa zdjęcia , #choroba scheuermanna operacja , #co na katar zatokowy , #cukrzyca typu lada , #cysta naskórkowa , #cystoskopia boli , #cytologia płynna , #czepota puszysta ,