Wynik transplantacji krwi pępowinowej od pokrewnych i niepowiązanych dawców ad 7

Stwierdziliśmy, że liczba komórek jądrzastych podawanych w jednym kilogramie była głównym czynnikiem w odzyskiwaniu liczby neutrofilów i płytek krwi. Wśród biorców krwi pępowinowej od pokrewnych dawców ci, którzy otrzymali mniej niż 37 milionów komórek jądrzastych na kilogram, przyjęli medianę 35 dni (zakres od 8 do 49), aby osiągnąć bezwzględną liczbę neutrofilów wynoszącą co najmniej 500 komórek na milimetr sześcienny i mediana 53 dni (zakres od 16 do 180...

Randomizowana próba zaawansowanej terapii wczesnej kiły u pacjentów z zakażeniem wirusem niedoboru odporności i bez niego czesc 4

Reakcje Jarischa-Herxheimera częściej występowały u pacjentów zakażonych HIV (22 procent, w porównaniu z 12 procent u osób bez zakażenia HIV, p = 0,02), podobnie jak gorączka (18 procent w porównaniu z 7 procentami, p = 0,005) i nudności lub rozstrój żołądkowo-jelitowy (26 procent vs. 15 procent, P = 0,02). Pacjenci otrzymujący wzmocnione leczenie nie różniły się od tych otrzymujących zwykłe leczenie pod względem szybkości obserwacji, zgodności z lekami lub przy...

Lepsza przeżywalność u pacjentów z miejscowo zaawansowanym rakiem prostaty leczonych za pomocą radioterapii i gosereliny czesc 4

Dwie grupy pacjentów były dobrze zrównoważone pod względem wieku, stanu sprawności WHO, stadium klinicznego, obecności lub braku przerzutów do węzłów chłonnych miednicy, stopnia histologicznego WHO, stopnia Gleasona, poziomu fosfatazy w surowicy krwi i poziomu PSA w linii podstawowej (tabela 1). Choroba sercowo-naczyniowa występowała u 29% pacjentów w grupie stosującej radioterapię iu 24% pacjentów w grupie leczonej łącznie; żadna przewlekła choroba nie została wymi...

Porównanie powtarzających się wysokich dawek i powtarzanych standardowych dawek epinefryny do zatrzymania akcji serca poza szpitalem czesc 4

W tym celu oryginalny produkt PCR CDR3 ponownie amplifikowano w objętości 50 .l z zagnieżdżonymi starterami VH i JH z sekwencjami M13 przyłączonymi do ich 5 końcach (sekwencje, M13 + VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG, M13R + JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). Produkty oczyszczono na żelu i bezpośrednio sekwencjonowano starterami do M13 w orientacji do przodu i M13R w orientacji odwrotnej i procedurą sekwencjonowania cyklu, w której stosowano terminatory...

Najnowsze zdjęcia w galerii polskaszkolawcork:

174#chondropatia rzepki , #choroba dercuma , #choroba duhringa zdjęcia , #choroba scheuermanna operacja , #co na katar zatokowy , #cukrzyca typu lada , #cysta naskórkowa , #cystoskopia boli , #cytologia płynna , #czepota puszysta ,