Immunologiczne choroby nerek

Ta książka, najobszerniejsza próba oceny immunologicznej podstawy chorób nerek, jest od dawna oczekiwana, ponieważ minęło ponad 50 lat, odkąd powstała podstawa odporności na wiele chorób nerek. Książka jest wieloputorska i zawiera wypowiedzi międzynarodowych ekspertów. Pierwsze dwie trzecie poświęcono podstawowym mechanizmom patogenetycz...

Metabolizm immunoglobulin w ataksji teleangiektazji

W tym celu oryginalny produkt PCR CDR3 ponownie amplifikowano w objętości 50 .l z zagnieżdżonymi starterami VH i JH z sekwencjami M13 przyłączonymi do ich 5 końcach (sekwencje, M13 + VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG, M13R + JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). Produkty oczyszczono na żelu i bezpośrednio sekwencjonowano st...

Najnowsze zdjęcia w galerii polskaszkolawcork:

174#choroba dercuma , #choroba duhringa zdjęcia , #choroba scheuermanna operacja , #co na katar zatokowy , #cukrzyca typu lada , #cysta naskórkowa , #cystoskopia boli , #cytologia płynna , #czepota puszysta , #choroba scheuermanna ,