Klonalność w ziarniniakowej dominującej limfocytach ad

W tym celu oryginalny produkt PCR CDR3 ponownie amplifikowano w objętości 50 .l z zagnieżdżonymi starterami VH i JH z sekwencjami M13 przyłączonymi do ich 5 końcach (sekwencje, M13 + VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG, M13R + JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). Produkty oczyszczono na żelu i bezpośrednio sekwencjonowano starterami do M13 w orientacji do przodu i M13R w orientacji odwrotn...

Lepsza przeżywalność u pacjentów z miejscowo zaawansowanym rakiem prostaty leczonych za pomocą radioterapii i gosereliny ad 5

Prognoza Kaplan-Meier okresu wolnego od choroby. Ta krzywa pokazuje odsetek pacjentów, którzy przeżyli, którzy byli wolni od choroby w każdym punkcie czasowym. Metoda uwzględnia proces cenzury. Liczba pacjentów, którzy są zagrożeni zdarzeniem w każdym punkcie czasowym, to całkowita liczba pacjentów minus liczba pacjentów, u których nastąpiła progresja choroby lub którzy zostali utraceni w wyniku obser...

Kontrolowana próba programu edukacyjnego mającego na celu zapobieganie urazom kręgosłupa ad 7

Wiek, kategoria rzemieślnicza, czas zatrudnienia i historia urazu lędźwiowego przed rozpoczęciem badania nie miały wpływu na prawdopodobieństwo powtórnego urazu. Kiedy kontrolowaliśmy wagę początkowego urazu, czas wolny od pracy wynikający z początkowego urazu i płci, stwierdziliśmy, że zadanie w grupie badawczej, przypisanie do szkolenia lub brak przeszkolenia po kontuzji, lub czy przedmiot został fak...

OBLICZANIE SRUB ZWYCZAJNYCH

Dodatkowo, w celu określenia zależności MAF lub niezależności inhibitorów CCND2 zidentyfikowanych podczas wstępnego badania przesiewowego, inhibitory były ponownie testowane w drugorzędowym badaniu przesiewowym, zarówno w obecności, jak i pod nieobecność wektora MAF. W związku z tym nasze badania pierwotne i wtórne mogłyby identyfikować i rozróżniać leki, które powodowały zależną od MAF lub niez...

Najnowsze zdjęcia w galerii polskaszkolawcork:

174#choroba dercuma , #choroba duhringa zdjęcia , #choroba scheuermanna operacja , #co na katar zatokowy , #cukrzyca typu lada , #cysta naskórkowa , #cystoskopia boli , #cytologia płynna , #czepota puszysta , #choroba scheuermanna ,