Klonalność w ziarniniakowej dominującej limfocytach ad

W tym celu oryginalny produkt PCR CDR3 ponownie amplifikowano w objętości 50 .l z zagnieżdżonymi starterami VH i JH z sekwencjami M13 przyłączonymi do ich 5 końcach (sekwencje, M13 + VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG, M13R + JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). Produkty oczyszczono na żelu i bezpośrednio sekwencjonowano starterami do M13 w orientacji do przodu i M13R w orientacji odwrotnej i procedurą sekwencjonowania cyklu, w której stosowano terminatory łańcucha fluorescencyjnego dideoksynukleotydu (Applied Biosystems, Foster City, CA). 24 Sekwencje analizowano za po...

Identyfikacja rybozydu kinetyny jako represora CCND1 i CCND2 z przedkliniczną aktywnością przeciwpłytkową ad 6

W szczególności komórki nowotworowe MM stały się CD138 negatywne w odpowiedzi na leczenie rybozydem kinetyny; utrata powierzchniowej CD138 podczas apoptozy komórek plazmatycznych jest dobrze ustalona (23) i jest związana z dodatnim wynikiem aneksyny V po leczeniu rybozydem kinetynowym (patrz Suplementowa Figura 2). Ponieważ zarodki myszy pozbawione cyklin D w końcu umierają na skutek niedokrwienia krwiotwórczej (4), można przewidzieć, że szpik kostny będzie wrażliwy na leki nakierowane na cyklinę D, szczególnie jeśli wszystkie cykliny 3 D zostaną zahamowane. W związku z tym potraktow...

Identyfikacja rybozydu kinetyny jako represora CCND1 i CCND2 z przedkliniczną aktywnością przeciwpłytkową ad 5

Przebieg czasowy aktywności rybozydu kinetyny oceniano następnie w komórkach H929. Rybozyd kinetyny powodował supresję białek cykliny D1 i D2 w ciągu 6 godzin; jednak cyklina D3 nie uległa istotnemu wpływowi dopiero później, kiedy pewna część komórek prawdopodobnie ulegała apoptozie (patrz poniżej). Aby sprawdzić, czy supresja cykliny D1 i D2 indukowana przez kinetynę rybosid jest bezpośrednim efektem i nie występuje wtórnie do zatrzymania komórkowego w fazie S, gdy CCND1 i CCND2 są normalnie obniżone (22), zbadaliśmy wpływ rybosodu kinetin na cykl komórkowy HMCL hodowany w st...

KONSTRUKCJE MIESZANE

Ważnym i nierozwiązanym problemem jest leczenie pacjentów z idiopatyczną plamicą małopłytkową, u których utrzymuje się ciężka trombocytopenia pomimo splenektomii. W wydaniu z 2 czerwca 1994 r. Andersen odnotował doskonałe wyniki u 10 pacjentów z oporną na leczenie idiopatyczną plamicą małopłytkową (5 mężczyzn i 5 kobiet) leczonych wysokodawkowym deksametazonem.1 U wszystkich pacjentów, którzy ukończyli sześć cykli leczenia deksametazonem ( 40 mg na dobę przez 4 kolejne dni co 28 dni), liczba płytek krwi nie tylko wzrosła, ale pozostała powyżej 100 x 109 na litr przez co n...

Najnowsze zdjęcia w galerii polskaszkolawcork:

174#choroba duhringa zdjęcia , #choroba scheuermanna operacja , #co na katar zatokowy , #cukrzyca typu lada , #cysta naskórkowa , #cystoskopia boli , #cytologia płynna , #czepota puszysta , #choroba scheuermanna , #kortykosteroidy ,