Lepsza przeżywalność u pacjentów z miejscowo zaawansowanym rakiem prostaty leczonych za pomocą radioterapii i gosereliny cd

Niedobór regionalny w obszarach węzłów chłonnych miednicznych lub paraaortycznych wykazano za pomocą ultrasonografii lub CT i potwierdzono biopsją. Odległe przerzuty w kościach, narządach miąższowych lub tkankach miękkich zidentyfikowano radiologicznie, a następnie biopsyjnie, jeśli uzna się to za konieczne. Zapewnienie jakości
Kalibrację każdego liniowego akceleratora uzyskan...

Klonalność w ziarniniakowej dominującej limfocytach ad

W tym celu oryginalny produkt PCR CDR3 ponownie amplifikowano w objętości 50 .l z zagnieżdżonymi starterami VH i JH z sekwencjami M13 przyłączonymi do ich 5 końcach (sekwencje, M13 + VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG, M13R + JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). Produkty oczyszczono na żelu i bezpośrednio sekwencjonowano starterami do M13 w orientacji do przodu i M13R w or...

Probukol i multiwitaminy w zapobieganiu restenozy po angioplastyki wieńcowej ad

Wszyscy pacjenci, u których plastyka naczyń powiodła się i którzy nie mieli powikłań kardiologicznych związanych z zabiegiem, nadal otrzymywali przypisane leczenie do czasu wykonania angiografii kontrolnej. Procedura angioplastyki i metody angiograficzne
Wszyscy pacjenci otrzymywali aspirynę (325 mg na dobę) przez cały okres badania. Przeprowadzono angioplastykę balonową zgodnie ze ...

Blokada angiotensyny II w zespole Marfana

Częstość serologicznie definiowanego niepowodzenia leczenia była podobna u pacjentów zakażonych HIV z odsetkiem CD4 wynoszącym 14 procent lub więcej oraz pacjentów z odsetkiem CD4 poniżej 14 procent. Częstość serologicznie zdefiniowanego niepowodzenia leczenia nie różniła się w zależności od przypisania leczenia (Tabela 2 i Tabela 3). Średni spadek miana szybkiej immunoterapii w oso...

Najnowsze zdjęcia w galerii polskaszkolawcork:

174#choroba scheuermanna operacja , #co na katar zatokowy , #cukrzyca typu lada , #cysta naskórkowa , #cystoskopia boli , #cytologia płynna , #czepota puszysta , #choroba scheuermanna , #kortykosteroidy , #dehydratacja ,