Doustne leki przeciwzakrzepowe

Żylna choroba zakrzepowo-zatorowa i tętnicza choroba zakrzepowo-zatorowa są głównymi przyczynami chorobowości i umieralności w krajach rozwiniętych. W ciągu ostatnich dwudziestu lat nastąpił znaczny postęp w zrozumieniu mechanizmów zakrzepowo-zatorowych, w postępowaniu klinicznym oraz w profilaktyce. Doustne leki przeciwzakrzepowe są stosowane od ponad 50 lat, ale ich rola w leczeniu i zapobieganiu chorobie zakrzepowo-zatorowej została ostatnio znacznie rozszerzona. Istnieją dwa powody: doskonałe, randomizowane badan...

Klonalność w ziarniniakowej dominującej limfocytach ad

W tym celu oryginalny produkt PCR CDR3 ponownie amplifikowano w objętości 50 .l z zagnieżdżonymi starterami VH i JH z sekwencjami M13 przyłączonymi do ich 5 końcach (sekwencje, M13 + VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG, M13R + JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). Produkty oczyszczono na żelu i bezpośrednio sekwencjonowano starterami do M13 w orientacji do przodu i M13R w orientacji odwrotnej i procedurą sekwencjonowania cyklu, w której stosowano terminatory łańcucha fluorescencyjnego dideoksynukleotyd...

Probukol i multiwitaminy w zapobieganiu restenozy po angioplastyki wieńcowej

Wysoka częstość nawrotów po angioplastyce balonowej nadal ogranicza długoterminowe powodzenie zabiegu.1 Przeprowadzono próby kliniczne kilku środków farmakologicznych, aby zapobiec restenozie, ale żadna z nich nie okazała się przydatna. Dane z badań na zwierzętach wykazały korzystny wpływ przeciwutleniaczy na proliferację komórek i przebudowę tętnic po angioplastyce balonowej.2-5 Ponadto kilka niewielkich badań zasugerowało obiecującą rolę leków o właściwościach przeciwutleniających w zapobieganiu restenoz...

Najnowsze zdjęcia w galerii polskaszkolawcork:

174#bulging krążka międzykręgowego , #choroba duhringa , #całując się z językiem wymieniasz , #deksametazon , #chloniak hodgkina , #chondropatia rzepki , #choroba dercuma , #choroba duhringa zdjęcia , #choroba scheuermanna operacja , #co na katar zatokowy ,