Randomizowana próba zaawansowanej terapii wczesnej kiły u pacjentów z zakażeniem wirusem niedoboru odporności i bez niego ad

Randomizację przeprowadzono w CDC w blokach 10 pacjentów stratyfikowanych według miejsca badania. Podczas pierwszej wizyty oraz w 2 tygodnie i 1, 2, 3, 6, 9 i 12 miesięcy przeprowadzono wywiad z pacjentami i zbadano je oraz pobrano próbki surowicy. Krew uzyskano dla analiz limfocytów podczas drugiej wizyty. Nakłucia lędźwiowe były zalecane dla wszystkich pa...

Probukol i multiwitaminy w zapobieganiu restenozy po angioplastyki wieńcowej ad

Wszyscy pacjenci, u których plastyka naczyń powiodła się i którzy nie mieli powikłań kardiologicznych związanych z zabiegiem, nadal otrzymywali przypisane leczenie do czasu wykonania angiografii kontrolnej. Procedura angioplastyki i metody angiograficzne
Wszyscy pacjenci otrzymywali aspirynę (325 mg na dobę) przez cały okres badania. Przeprowadzono...

Napad padaczkowy.

W tym celu oryginalny produkt PCR CDR3 ponownie amplifikowano w objętości 50 .l z zagnieżdżonymi starterami VH i JH z sekwencjami M13 przyłączonymi do ich 5 końcach (sekwencje, M13 + VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG, M13R + JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). Produkty oczyszczono na żelu i bezpośrednio sekwencjonowano starterami do M...

Najnowsze zdjęcia w galerii polskaszkolawcork:

174#brak odruchu kolanowego , #brodawka lojotokowa , #bulging krążka międzykręgowego , #choroba duhringa , #całując się z językiem wymieniasz , #deksametazon , #chloniak hodgkina , #chondropatia rzepki , #choroba dercuma , #choroba duhringa zdjęcia ,