Ceftriakson w porównaniu z doksycykliną w leczeniu ostrej rozsianym boreliozie

Choroba z Lyme jest chorobą zakaźną wywoływaną przez kleszczowy krętek Borrelia burgdorferi.1 Chociaż nie występuje u wszystkich pacjentów, najwcześniejszym i najłatwiej rozpoznawanym objawem infekcji B. burgdorferi jest zmiana skórna znana jako rumień wędrujący. Rozpowszechnianie krętka w wielu narządach i tkankach, w tym w ośrodkowym układzie nerwowym, pojawia się we wczesnej fazie ...

Deksametazon o wysokiej dawce pulsacyjnej pod kątem trombocytopenii immunologicznej

Ważnym i nierozwiązanym problemem jest leczenie pacjentów z idiopatyczną plamicą małopłytkową, u których utrzymuje się ciężka trombocytopenia pomimo splenektomii. W wydaniu z 2 czerwca 1994 r. Andersen odnotował doskonałe wyniki u 10 pacjentów z oporną na leczenie idiopatyczną plamicą małopłytkową (5 mężczyzn i 5 kobiet) leczonych wysokodawkowym deksametazonem.1 U wszystkich pacjen...

Klonalność w ziarniniakowej dominującej limfocytach ad

W tym celu oryginalny produkt PCR CDR3 ponownie amplifikowano w objętości 50 .l z zagnieżdżonymi starterami VH i JH z sekwencjami M13 przyłączonymi do ich 5 końcach (sekwencje, M13 + VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG, M13R + JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). Produkty oczyszczono na żelu i bezpośrednio sekwencjonowano starterami do M13 w orientacji do przodu i M13R w ori...

Komórki epidermy

Konieczne będą badania porównawcze zarówno na poziomie przedklinicznym, jak i klinicznym, w celu określenia, które kombinacje oferują najbardziej skuteczne metody z najmniejszą toksycznością. Kliniczny rozwój PARAs PARAs w fazie rozwoju, mapatumumab ukierunkowany na DR4 mapatumumab jest przedmiotem najbardziej zaawansowanych badań, z wynikami II fazy (Tabela 3). Dane Fazy I istnieją równie...

Najnowsze zdjęcia w galerii polskaszkolawcork:

174#brak odruchu kolanowego , #brodawka lojotokowa , #bulging krążka międzykręgowego , #choroba duhringa , #całując się z językiem wymieniasz , #deksametazon , #chloniak hodgkina , #chondropatia rzepki , #choroba dercuma , #choroba duhringa zdjęcia ,